Biostar214299

Last commit

Extract allele specific reads from bamfiles

Usage

This program is now part of the main jvarkit tool. See jvarkit for compiling.

Usage: java -jar dist/jvarkit.jar biostar214299  [options] Files

Usage: biostar214299 [options] Files
  Options:
    --bamcompression
      Compression Level. 0: no compression. 9: max compression;
      Default: 5
    -h, --help
      print help and exit
    --helpFormat
      What kind of help. One of [usage,markdown,xml].
    -o, --out
      Output file. Optional . Default: stdout
    -p, --positions
      Position file. Or use --vcf . A Tab delimited file containing the 
      following 4 column: (1)chrom (2)position (3) allele A/T/G/C (4) sample 
      name. 
    -R, --reference
      Indexed fasta Reference file. This file must be indexed with samtools 
      faidx and with picard/gatk CreateSequenceDictionary or samtools dict
    --regions
      Limit analysis to this interval. A source of intervals. The following 
      suffixes are recognized: vcf, vcf.gz bed, bed.gz, gtf, gff, gff.gz, 
      gtf.gz.Otherwise it could be an empty string (no interval) or a list of 
      plain interval separated by '[ \t\n;,]'
    --samoutputformat
      Sam output format.
      Default: SAM
      Possible Values: [BAM, SAM, CRAM]
    --validation-stringency
      SAM Reader Validation Stringency
      Default: LENIENT
      Possible Values: [STRICT, LENIENT, SILENT]
    -V, --vcf
      VCF file. Or use --positions . A VCF file with genotypes. Warning: Only 
      ALT alleles for SINGLETONS are detected.
    --version
      print version and exit
    -a
      skip ambigous reads (with multiple samples)
      Default: false
    -n
      skip unaffected reads (with no samples)
      Default: false
    -u
      skip unmapped reads
      Default: false

Keywords

  • sam
  • bam
  • variant
  • snp

See also in Biostars

Creation Date

20160930

Source code

https://github.com/lindenb/jvarkit/tree/master/src/main/java/com/github/lindenb/jvarkit/tools/biostar/Biostar214299.java

Unit Tests

https://github.com/lindenb/jvarkit/tree/master/src/test/java/com/github/lindenb/jvarkit/tools/biostar/Biostar214299Test.java

Contribute

License

The project is licensed under the MIT license.

Citing

Should you cite biostar214299 ? https://github.com/mr-c/shouldacite/blob/master/should-I-cite-this-software.md

The current reference is:

http://dx.doi.org/10.6084/m9.figshare.1425030

Lindenbaum, Pierre (2015): JVarkit: java-based utilities for Bioinformatics. figshare. http://dx.doi.org/10.6084/m9.figshare.1425030

The program removes all the existing read group and create some new one from the 'position file'. For now, only simple alleles are supported. Reads group are affected if a specific variant is found in the 'position file'. If two samples share the same group, the read group is AMBIGOUS. If the read is unmapped, the read group is UNMAPPED. If no sample is affected to a read, the read group will be UNAFFECTED;

see also:

Example

the positions file

$ cat positions.tsv
rotavirus       267     C       SAMPLE1
rotavirus       267     G       SAMPLE2

processing :

$ java -jar dist/jvarkit.jar biostar214299 -p positions.tsv input.bam

@HD     VN:1.5  SO:coordinate
@SQ     SN:rotavirus    LN:1074
@RG     ID:UNAFFECTED   SM:UNAFFECTED   LB:UNAFFECTED
@RG     ID:UNMAPPED     SM:UNMAPPED     LB:UNMAPPED
@RG     ID:SAMPLE1      SM:SAMPLE1      LB:SAMPLE1
@RG     ID:SAMPLE2      SM:SAMPLE2      LB:SAMPLE2
@RG     ID:AMBIGOUS     SM:AMBIGOUS     LB:AMBIGOUS
(...)
rotavirus_237_744_6:0:0_3:0:0_29c       163     rotavirus       237     60      70M     =       675     508     ATCCGGCGTTAAATGGAAAGTTTCGGTGATCTATTAGAAATAGAAATTGGATGACTGATTCAAAAACGGT  ++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++      MD:Z:3A19A1C1C1G31T8    RG:Z:SAMPLE1    NM:i:6  AS:i:41 XS:i:0
rotavirus_234_692_6:0:1_4:0:0_3ac       163     rotavirus       237     60      6S30M5I1M5D28M  =       623     456     TTGGTAATCAGGCGTTAAATGGAAAGTTTAGCTCAGGACAACGAAATAGAAATTGGATGACTGATTCTAA  ++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++      MD:Z:31^TATTA28 RG:Z:SAMPLE2    NM:i:10 AS:i:37 XS:i:0
rotavirus_237_777_6:0:0_7:0:0_216       99      rotavirus       237     60      70M     =       708     541     ATCAGGGGTTAAATTGAAAGTTTAGCTCAGCTCTTAGACATAGAAATTGGATGACTGATTGTACAACGGT  ++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++      MD:Z:6C7G17A5A21C2A6    RG:Z:SAMPLE1    NM:i:6  AS:i:40 XS:i:0
rotavirus_237_699_3:0:0_8:0:0_22f       163     rotavirus       237     60      70M     =       650     463     ATGAGGCGTTAAATGGAAAGTTTATCTCAGCTATTAGAAATAGCAATTGGATGACTGATTCTAAAACGGT  ++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++      MD:Z:2C21G18A26 RG:Z:SAMPLE1    NM:i:3  AS:i:57 XS:i:0
(...)
rotavirus_311_846_10:0:0_11:0:0_3d7     141     *       0       0       *       *       0       0       AACTTAGATGAAGACGATCAAAACCTTAGAATGACTTTATGTTCTAAATGGCTCGACCCAAAGATGAGAG  ++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++      RG:Z:UNMAPPED   AS:i:0  XS:i:0
rotavirus_85_600_7:0:0_9:0:0_3e0        77      *       0       0       *       *       0       0       AGCTGCAGTTGTTTCTGCTCCTTCAACATTAGAATTACTGGGTATTGAATATGATTCCAATGAAGTCTAT  ++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++      RG:Z:UNMAPPED   AS:i:0  XS:i:0
rotavirus_85_600_7:0:0_9:0:0_3e0        141     *       0       0       *       *       0       0       TATTTCTCCTTAAGCCTGTGTTTTATTGCATCAAATCTTTTTTCAAACTGCTCATAACGAGATTTCCACT  ++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++      RG:Z:UNMAPPED   AS:i:0  XS:i:0
$ java -jar dist/jvarkit.jar biostar214299 -R src/test/resources/rotavirus_rf.fa -V src/test/resources/rotavirus_rf.vcf.gz src/test/resources/S2.bam -u -n 2> /dev/null | grep -v "^@" 
RF02_817_1370_1:0:0_1:0:0_8f    99      RF02    817     60      70M     =       1301    554     TGATATAATATTCAATTACATTCCTGAAAGGATAAGGAATGACGTTAACTATATACTTAAAATGGACAGA       2222222222222222222222222222222222222222222222222222222222222222222222  RG:Z:S1 NM:i:1  AS:i:65 XS:i:0
RF04_700_1259_0:0:0_3:0:0_33    147     RF04    1190    60      70M     =       700     -560    ATCCAGTTATCACTGGGGGTGCTGTGTCATTGCATGCAGCAGGTGTAACTTGATCAACGCAGTTTACAGA       2222222222222222222222222222222222222222222222222222222222222222222222  RG:Z:S4 NM:i:3  AS:i:55 XS:i:0

Cited In

  • Anatomy, transcription dynamics and evolution of wheat ribosomal RNA loci deciphered by a multi-omics approach. https://doi.org/10.1101/2020.08.29.273623
  • Reciprocal allopolyploid grasses (Festuca X Lolium) display stable patterns of genome dominance . Marek Glombik & al. 2021. The plant journal. doi:10.1111/tpj.15375
  • Fine structure and transcription dynamics of bread wheat ribosomal DNA loci deciphered by a multi-omics approach. Z Tulpova & al. 2022. The Plante Genome. https://doi.org/10.1002/tpg2.20191
  • Watson CM, Jackson L, Crinnion LA, et al. Long-read sequencing to resolve the parent of origin of a de novo pathogenic UBE3A variant. Journal of Medical Genetics Published Online First: 12 April 2022. doi: 10.1136/jmedgenet-2021-108314
  • Benjamin McClinton, Christopher M. Watson, Laura A. Crinnion, Martin McKibbin, Manir Ali, Chris F. Inglehearn, Carmel Toomes, Haplotyping Using Long-Range PCR and Nanopore Sequencing of Phase Variants; Lessons Learned From the ABCA4 Locus, Laboratory Investigation, 2023, 100160, ISSN 0023-6837
  • Shinde SS, Sharma A and Vijay N (2023) Decoding the fibromelanosis locus complex chromosomal rearrangement of black-bone chicken: genetic differentiation, selective sweeps and protein-coding changes in Kadaknath chicken. Front. Genet. 14:1180658. doi: 10.3389/fgene.2023.1180658
  • Hany U, Watson CM, Liu L, et al. Novel Ameloblastin Variants, Contrasting Amelogenesis Imperfecta Phenotypes. Journal of Dental Research. 2023;0(0). doi:10.1177/00220345231203694
  • Malena Daich Varela, Elena Schiff, Samantha Malka, Genevieve Wright, Omar A. Mahroo, Andrew R. Webster, Michel Michaelides, Gavin Arno; PHYH c.678+5G>T Leads to In-Frame Exon Skipping and Is Associated With Attenuated Refsum Disease. Invest. Ophthalmol. Vis. Sci. 2024;65(2):38. https://doi.org/10.1167/iovs.65.2.38