Biostar214299

Extract allele specific reads from bamfiles
Usage
This program is now part of the main jvarkit tool. See jvarkit for compiling.
Usage: java -jar dist/jvarkit.jar biostar214299 [options] Files
Usage: biostar214299 [options] Files
Options:
--bamcompression
Compression Level. 0: no compression. 9: max compression;
Default: 5
-h, --help
print help and exit
--helpFormat
What kind of help. One of [usage,markdown,xml].
-o, --out
Output file. Optional . Default: stdout
-p, --positions
Position file. Or use --vcf . A Tab delimited file containing the
following 4 column: (1)chrom (2)position (3) allele A/T/G/C (4) sample
name.
-R, --reference
Indexed fasta Reference file. This file must be indexed with samtools
faidx and with picard/gatk CreateSequenceDictionary or samtools dict
--regions
Limit analysis to this interval. A source of intervals. The following
suffixes are recognized: vcf, vcf.gz bed, bed.gz, gtf, gff, gff.gz,
gtf.gz.Otherwise it could be an empty string (no interval) or a list of
plain interval separated by '[ \t\n;,]'
--samoutputformat
Sam output format.
Default: SAM
Possible Values: [BAM, SAM, CRAM]
--validation-stringency
SAM Reader Validation Stringency
Default: LENIENT
Possible Values: [STRICT, LENIENT, SILENT]
-V, --vcf
VCF file. Or use --positions . A VCF file with genotypes. Warning: Only
ALT alleles for SINGLETONS are detected.
--version
print version and exit
-a
skip ambigous reads (with multiple samples)
Default: false
-n
skip unaffected reads (with no samples)
Default: false
-u
skip unmapped reads
Default: false
Keywords
- sam
- bam
- variant
- snp
See also in Biostars
Creation Date
20160930
Source code
Unit Tests
Contribute
- Issue Tracker: http://github.com/lindenb/jvarkit/issues
- Source Code: http://github.com/lindenb/jvarkit
License
The project is licensed under the MIT license.
Citing
Should you cite biostar214299 ? https://github.com/mr-c/shouldacite/blob/master/should-I-cite-this-software.md
The current reference is:
http://dx.doi.org/10.6084/m9.figshare.1425030
Lindenbaum, Pierre (2015): JVarkit: java-based utilities for Bioinformatics. figshare. http://dx.doi.org/10.6084/m9.figshare.1425030
The program removes all the existing read group and create some new one from the 'position file'. For now, only simple alleles are supported. Reads group are affected if a specific variant is found in the 'position file'. If two samples share the same group, the read group is AMBIGOUS. If the read is unmapped, the read group is UNMAPPED. If no sample is affected to a read, the read group will be UNAFFECTED;
see also:
- https://www.biostars.org/p/283969 " How to extract reads with a known variant form a bam file"
Example
the positions file
$ cat positions.tsv
rotavirus 267 C SAMPLE1
rotavirus 267 G SAMPLE2
processing :
$ java -jar dist/jvarkit.jar biostar214299 -p positions.tsv input.bam
@HD VN:1.5 SO:coordinate
@SQ SN:rotavirus LN:1074
@RG ID:UNAFFECTED SM:UNAFFECTED LB:UNAFFECTED
@RG ID:UNMAPPED SM:UNMAPPED LB:UNMAPPED
@RG ID:SAMPLE1 SM:SAMPLE1 LB:SAMPLE1
@RG ID:SAMPLE2 SM:SAMPLE2 LB:SAMPLE2
@RG ID:AMBIGOUS SM:AMBIGOUS LB:AMBIGOUS
(...)
rotavirus_237_744_6:0:0_3:0:0_29c 163 rotavirus 237 60 70M = 675 508 ATCCGGCGTTAAATGGAAAGTTTCGGTGATCTATTAGAAATAGAAATTGGATGACTGATTCAAAAACGGT ++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++ MD:Z:3A19A1C1C1G31T8 RG:Z:SAMPLE1 NM:i:6 AS:i:41 XS:i:0
rotavirus_234_692_6:0:1_4:0:0_3ac 163 rotavirus 237 60 6S30M5I1M5D28M = 623 456 TTGGTAATCAGGCGTTAAATGGAAAGTTTAGCTCAGGACAACGAAATAGAAATTGGATGACTGATTCTAA ++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++ MD:Z:31^TATTA28 RG:Z:SAMPLE2 NM:i:10 AS:i:37 XS:i:0
rotavirus_237_777_6:0:0_7:0:0_216 99 rotavirus 237 60 70M = 708 541 ATCAGGGGTTAAATTGAAAGTTTAGCTCAGCTCTTAGACATAGAAATTGGATGACTGATTGTACAACGGT ++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++ MD:Z:6C7G17A5A21C2A6 RG:Z:SAMPLE1 NM:i:6 AS:i:40 XS:i:0
rotavirus_237_699_3:0:0_8:0:0_22f 163 rotavirus 237 60 70M = 650 463 ATGAGGCGTTAAATGGAAAGTTTATCTCAGCTATTAGAAATAGCAATTGGATGACTGATTCTAAAACGGT ++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++ MD:Z:2C21G18A26 RG:Z:SAMPLE1 NM:i:3 AS:i:57 XS:i:0
(...)
rotavirus_311_846_10:0:0_11:0:0_3d7 141 * 0 0 * * 0 0 AACTTAGATGAAGACGATCAAAACCTTAGAATGACTTTATGTTCTAAATGGCTCGACCCAAAGATGAGAG ++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++ RG:Z:UNMAPPED AS:i:0 XS:i:0
rotavirus_85_600_7:0:0_9:0:0_3e0 77 * 0 0 * * 0 0 AGCTGCAGTTGTTTCTGCTCCTTCAACATTAGAATTACTGGGTATTGAATATGATTCCAATGAAGTCTAT ++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++ RG:Z:UNMAPPED AS:i:0 XS:i:0
rotavirus_85_600_7:0:0_9:0:0_3e0 141 * 0 0 * * 0 0 TATTTCTCCTTAAGCCTGTGTTTTATTGCATCAAATCTTTTTTCAAACTGCTCATAACGAGATTTCCACT ++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++ RG:Z:UNMAPPED AS:i:0 XS:i:0
$ java -jar dist/jvarkit.jar biostar214299 -R src/test/resources/rotavirus_rf.fa -V src/test/resources/rotavirus_rf.vcf.gz src/test/resources/S2.bam -u -n 2> /dev/null | grep -v "^@"
RF02_817_1370_1:0:0_1:0:0_8f 99 RF02 817 60 70M = 1301 554 TGATATAATATTCAATTACATTCCTGAAAGGATAAGGAATGACGTTAACTATATACTTAAAATGGACAGA 2222222222222222222222222222222222222222222222222222222222222222222222 RG:Z:S1 NM:i:1 AS:i:65 XS:i:0
RF04_700_1259_0:0:0_3:0:0_33 147 RF04 1190 60 70M = 700 -560 ATCCAGTTATCACTGGGGGTGCTGTGTCATTGCATGCAGCAGGTGTAACTTGATCAACGCAGTTTACAGA 2222222222222222222222222222222222222222222222222222222222222222222222 RG:Z:S4 NM:i:3 AS:i:55 XS:i:0
Cited In
- Anatomy, transcription dynamics and evolution of wheat ribosomal RNA loci deciphered by a multi-omics approach. https://doi.org/10.1101/2020.08.29.273623
- Reciprocal allopolyploid grasses (Festuca X Lolium) display stable patterns of genome dominance . Marek Glombik & al. 2021. The plant journal. doi:10.1111/tpj.15375
- Fine structure and transcription dynamics of bread wheat ribosomal DNA loci deciphered by a multi-omics approach. Z Tulpova & al. 2022. The Plante Genome. https://doi.org/10.1002/tpg2.20191
- Watson CM, Jackson L, Crinnion LA, et al. Long-read sequencing to resolve the parent of origin of a de novo pathogenic UBE3A variant. Journal of Medical Genetics Published Online First: 12 April 2022. doi: 10.1136/jmedgenet-2021-108314
- Benjamin McClinton, Christopher M. Watson, Laura A. Crinnion, Martin McKibbin, Manir Ali, Chris F. Inglehearn, Carmel Toomes, Haplotyping Using Long-Range PCR and Nanopore Sequencing of Phase Variants; Lessons Learned From the ABCA4 Locus, Laboratory Investigation, 2023, 100160, ISSN 0023-6837
- Shinde SS, Sharma A and Vijay N (2023) Decoding the fibromelanosis locus complex chromosomal rearrangement of black-bone chicken: genetic differentiation, selective sweeps and protein-coding changes in Kadaknath chicken. Front. Genet. 14:1180658. doi: 10.3389/fgene.2023.1180658
- Hany U, Watson CM, Liu L, et al. Novel Ameloblastin Variants, Contrasting Amelogenesis Imperfecta Phenotypes. Journal of Dental Research. 2023;0(0). doi:10.1177/00220345231203694
- Malena Daich Varela, Elena Schiff, Samantha Malka, Genevieve Wright, Omar A. Mahroo, Andrew R. Webster, Michel Michaelides, Gavin Arno; PHYH c.678+5G>T Leads to In-Frame Exon Skipping and Is Associated With Attenuated Refsum Disease. Invest. Ophthalmol. Vis. Sci. 2024;65(2):38. https://doi.org/10.1167/iovs.65.2.38