SortSamRefName
Sort a BAM on chromosome/contig and then on read/querty name
Usage
Usage: java -jar dist/sortsamrefname.jar [options] Files
Usage: sortsamrefname [options] Files
Options:
--bamcompression
Compression Level. 0: no compression. 9: max compression;
Default: 5
-h, --help
print help and exit
--helpFormat
What kind of help. One of [usage,markdown,xml].
--maxRecordsInRam
When writing files that need to be sorted, this will specify the number
of records stored in RAM before spilling to disk. Increasing this number
reduces the number of file handles needed to sort a file, and increases
the amount of RAM needed
Default: 50000
-o, --out
Output file. Optional . Default: stdout
-R, --reference
Indexed fasta Reference file. This file must be indexed with samtools
faidx and with picard/gatk CreateSequenceDictionary or samtools dict
--regions
Limit analysis to this interval. A source of intervals. The following
suffixes are recognized: vcf, vcf.gz bed, bed.gz, gtf, gff, gff.gz,
gtf.gz.Otherwise it could be an empty string (no interval) or a list of
plain interval separated by '[ \t\n;,]'
--samoutputformat
Sam output format.
Default: SAM
Possible Values: [BAM, SAM, CRAM]
--tmpDir
tmp working directory. Default: java.io.tmpDir
Default: []
--validation-stringency
SAM Reader Validation Stringency
Default: LENIENT
Possible Values: [STRICT, LENIENT, SILENT]
--version
print version and exit
Keywords
- sam
- sort
See also in Biostars
Compilation
Requirements / Dependencies
- java compiler SDK 11. Please check that this java is in the
${PATH}
. Setting JAVA_HOME is not enough : (e.g: https://github.com/lindenb/jvarkit/issues/23 )
Download and Compile
$ git clone "https://github.com/lindenb/jvarkit.git"
$ cd jvarkit
$ ./gradlew sortsamrefname
The java jar file will be installed in the dist
directory.
Creation Date
20150812
Source code
Unit Tests
Contribute
- Issue Tracker: http://github.com/lindenb/jvarkit/issues
- Source Code: http://github.com/lindenb/jvarkit
License
The project is licensed under the MIT license.
Citing
Should you cite sortsamrefname ? https://github.com/mr-c/shouldacite/blob/master/should-I-cite-this-software.md
The current reference is:
http://dx.doi.org/10.6084/m9.figshare.1425030
Lindenbaum, Pierre (2015): JVarkit: java-based utilities for Bioinformatics. figshare. http://dx.doi.org/10.6084/m9.figshare.1425030
Example
$ java -jar dist/sortsamrefname.jar /commun/data/packages/samtools/1.2/samtools/examples/toy.sam 2> /dev/null
@HD VN:1.4 SO:unsorted
@SQ SN:ref LN:45
@SQ SN:ref2 LN:40
@CO SortSamRefName 1c7bc5e674136947586779a2aac53e576db4a67f /commun/data/packages/samtools/1.2/samtools/examples/toy.sam
r001 83 ref 37 30 9M = 7 -39 CAGCGCCAT *
r001 163 ref 7 30 8M4I4M1D3M = 37 39 TTAGATAAAGAGGATACTG * XX:B:S,12561,2,20,112
r002 0 ref 9 30 1S2I6M1P1I1P1I4M2I * 0 0 AAAAGATAAGGGATAAA *
r003 0 ref 9 30 5H6M * 0 0 AGCTAA *
r003 16 ref 29 30 6H5M * 0 0 TAGGC *
r004 0 ref 16 30 6M14N1I5M * 0 0 ATAGCTCTCAGC *
x1 0 ref2 1 30 20M * 0 0 AGGTTTTATAAAACAAATAA ????????????????????
x2 0 ref2 2 30 21M * 0 0 GGTTTTATAAAACAAATAATT ?????????????????????
x3 0 ref2 6 30 9M4I13M * 0 0 TTATAAAACAAATAATTAAGTCTACA ??????????????????????????
x4 0 ref2 10 30 25M * 0 0 CAAATAATTAAGTCTACAGAGCAAC ?????????????????????????
x5 0 ref2 12 30 24M * 0 0 AATAATTAAGTCTACAGAGCAACT ????????????????????????
x6 0 ref2 14 30 23M * 0 0 TAATTAAGTCTACAGAGCAACTA ???????????????????????